Primer Formats¶

Amplirust accepts primers either inline on the command line or from a CSV file.

Command Line¶

Single primer pair:

-p "primer_name:FORWARD_SEQ:REVERSE_SEQ"

Multiple primer pairs (semicolon-separated):

-p "16S:AGAGTTTGATCMTGGCTCAG:TACGGYTACCTTGTTACGACTT;ITS:TCCGTAGGTGAACCTGCGG:TCCTCCGCTTATTGATATGC"

CSV File¶

Create a CSV file with the header name,forward,reverse:

name,forward,reverse
16S_V1V3,AGAGTTTGATCMTGGCTCAG,ATTACCGCGGCTGCTGG
16S_V3V4,CCTACGGGNGGCWGCAG,GACTACHVGGGTATCTAATCC
ITS1,TCCGTAGGTGAACCTGCGG,GCTGCGTTCTTCATCGATGC

Then reference the file:

-p primers.csv

Which format to use?

Use inline primers for quick one-off searches. Use a CSV file when you have multiple primer pairs or want to reuse primers across runs.

Pool Mode Primers¶

With --pool, primers are provided as individual sequences rather than forward/reverse pairs. Products are found between any two primers that match in correct orientation and distance.

Inline Format¶

Single primer:

--pool -p "primer_name:SEQUENCE"

Multiple primers (semicolon-separated):

--pool -p "p1:AGAGTTTGATCMTGGCTCAG;p2:GWATTACCGCGGCKGCTG;p3:CCTACGGGNGGCWGCAG"

CSV File (2 columns)¶

Create a CSV file with the header name,sequence:

name,sequence
27F,AGAGTTTGATCMTGGCTCAG
519R,GWATTACCGCGGCKGCTG
1492R,TACGGYTACCTTGTTACGACTT

Then reference the file:

--pool -p pool_primers.csv

When to use pool mode

Use pool mode (--pool) for multiplex panel design, MLST typing schemes, or exploratory primer screening where any two primers can form a product. Use --pool-self-match to also find products where the same primer acts as both forward and reverse.

IUPAC Ambiguity Codes¶

Primer sequences support standard IUPAC ambiguity codes. These codes are expanded during matching, allowing a single primer to match multiple sequence variants.

Code	Bases	Meaning
R	A, G	Purine
Y	C, T	Pyrimidine
S	G, C	Strong (3 H-bonds)
W	A, T	Weak (2 H-bonds)
K	G, T	Keto
M	A, C	Amino
B	C, G, T	Not A
D	A, G, T	Not C
H	A, C, T	Not G
V	A, C, G	Not T
N	A, C, G, T	Any

IUPAC Complement Pairs¶

When computing reverse complements, IUPAC codes follow these complement rules:

Code	Complement	Reason
R (A,G)	Y (C,T)	Purine ↔ Pyrimidine
S (G,C)	S (G,C)	Self-complementary
W (A,T)	W (A,T)	Self-complementary
K (G,T)	M (A,C)	Keto ↔ Amino
B (C,G,T)	V (A,C,G)	Not A ↔ Not T
D (A,G,T)	H (A,C,T)	Not C ↔ Not G
N	N	Any ↔ Any